WormMine: Gene WBGene00065508

• WormBase Gene ID: WBGene00065508
• Gene Name: Cre-mec-10
• Sequence Name: CRE21924
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable sodium channel activity. Predicted to be involved in sodium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans mec-10. In C. elegans, mec-10 is involved in positive regulation of multicellular organismal process and response to mechanical stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE21924.1	CRE21924.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE21924	CRE21924		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108164
• Remark: Cre-mec-10, GTGGTCTGGAGTCTCAGTAATGACTTGTTGCGAGTTTGTGTGTTTGGCAATTGAGCTATT, WBGene00065508
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region