WormMine: Gene WBGene00066595

• WormBase Gene ID: WBGene00066595
• Gene Name: Cre-lin-35
• Sequence Name: CRE03780
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in regulation of cell cycle and regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Is an ortholog of C. elegans lin-35. In C. elegans, lin-35 is involved in several processes, including negative regulation of cell cycle; negative regulation of vulval development; and positive regulation of brood size.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03780.1	CRE03780.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03780	CRE03780		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101133
• Remark: Cre-lin-35, AAAATTCATTATCGGACAAATCGATAGTGCTCTGGATGACGATCTTATGGAGATGCCAGT, WBGene00066595
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region