WormMine: Gene WBGene00067288

• WormBase Gene ID: WBGene00067288
• Gene Name: Cre-exc-7
• Sequence Name: CRE06975
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity. Predicted to be part of ribonucleoprotein complex. Is an ortholog of C. elegans exc-7. In C. elegans, exc-7 is involved in several processes, including epithelial cell development; regulation of alternative mRNA splicing, via spliceosome; and regulation of neuron differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06975.1	CRE06975.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06975	CRE06975		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104113
• Remark: Cre-exc-7, GTGTATAATTTGGCGGCGGATACGGATGACACTCTGTTATGGCAGTTGTTTTCACAGTTT, WBGene00067288
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region