WormMine: Gene WBGene00067904

• WormBase Gene ID: WBGene00067904
• Gene Name: CRE05879
• Sequence Name: CRE05879
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and protein folding chaperone. Predicted to be involved in protein folding. Is an ortholog of C. elegans Y22D7AL.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05879.1	CRE05879.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05879	CRE05879		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

• Primary Identifier: Expr1096028
• Remark: CRE05879, GTCGAGGATAAGGAATACTCGATCTTCCGCGAGTCTGATCTTCTCGGAGTCTTCCACTAA, WBGene00067904
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region