WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00068388 Gene Name  Cre-zag-1
Sequence Name  ? CRE10982 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable DNA binding activity. Is an ortholog of C. elegans zag-1. In C. elegans, zag-1 is involved in several processes, including negative regulation of transcription by RNA polymerase II; neuron differentiation; and regulation of cell differentiation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE10982.1 CRE10982.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE10982 CRE10982   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE22276, ATGCCCTGAATGGAAGTCTGACAGTGAGCCCGTCCTCGTCGAATACACCACCTCCAAATT, WBGene00083321   Expr1095677 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-zag-1, AACACAAACGCCTCCACTCCGGAGAGAAACCATTCCAATGCGACAAATGTCTGAAGCGAT, WBGene00068388   Expr1096401 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region