WormMine: Gene WBGene00068850

• WormBase Gene ID: WBGene00068850
• Gene Name: CRE31246
• Sequence Name: CRE31246
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA-binding transcription factor activity and sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans unc-130. In C. elegans, unc-130 is involved in several processes, including axon extension involved in axon guidance; negative regulation of transcription by RNA polymerase II; and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31246.1	CRE31246.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31246	CRE31246		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099519
• Remark: CRE31246, CCAGTTGACACTTGCAGAAATCTATAATTGGATTATGATGCTTTTCCCGTTTTACCTGAA, WBGene00068850
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region