WormMine: Gene WBGene00068906

• WormBase Gene ID: WBGene00068906
• Gene Name: CRE02627
• Sequence Name: CRE02627
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 7S RNA binding activity; GTP binding activity; and ribonucleoside triphosphate phosphatase activity. Predicted to be involved in SRP-dependent cotranslational protein targeting to membrane. Predicted to be part of signal recognition particle. Is an ortholog of C. elegans F21D5.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02627.1	CRE02627.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02627	CRE02627		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107890
• Remark: CRE02627, GCCGGATTAGTGGATATGGTCAATGATATTGGAATTCAGGATAACAAGGAGTTGGTTGGC, WBGene00068906
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region