WormMine: Gene WBGene00068907

• WormBase Gene ID: WBGene00068907
• Gene Name: CRE24254
• Sequence Name: CRE24254
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ubiquitin protein ligase activity and zinc ion binding activity. Predicted to be involved in ubiquitin-dependent protein catabolic process via the N-end rule pathway. Is an ortholog of C. elegans ubr-1. In C. elegans, ubr-1 is involved in negative regulation of glutamate metabolic process and regulation of backward locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24254.1	CRE24254.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24254	CRE24254		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102359
• Remark: CRE24254, CGATGTGGAAGCGTGGCTGGAAGGATACGCTTGTGCGAACCATAAAAAGAAAGACGAGGA, WBGene00068907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region