WormMine: Gene WBGene00069185

• WormBase Gene ID: WBGene00069185
• Gene Name: Cre-atp-2
• Sequence Name: CRE29320
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and proton-transporting ATP synthase activity, rotational mechanism. Predicted to be involved in proton motive force-driven ATP synthesis and proton transmembrane transport. Predicted to be part of proton-transporting ATP synthase complex, catalytic core F(1). Is an ortholog of C. elegans atp-2. In C. elegans, atp-2 is involved in several processes, including determination of adult lifespan; inductive cell migration; and nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29320.1	CRE29320.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29320	CRE29320		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in unactivated C. remanei spermatids.	N.A	WBPaper00054996:unactivated_spermatid_CRE

1 Expression Patterns

• Primary Identifier: Expr1112414
• Remark: Cre-atp-2, AATCGATGATGTGTTCCAGAAGGCCGAGGAGCTCGCCAAGCAACACGCCGAAAGACAACA, WBGene00069185
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region