WormMine: Gene WBGene00069301

• WormBase Gene ID: WBGene00069301
• Gene Name: CRE09057
• Sequence Name: CRE09057
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-4. In C. elegans, gcy-4 is involved in chemosensory behavior; chemotaxis; and response to salt.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE09057.1	CRE09057.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE09057	CRE09057		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104916
• Remark: CRE09057, TCAGAAATTTCGAATTCCTCACTTACCGAGAGAACGTGTAGAGCTAAGGGTTGGGATTAA, WBGene00069301
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region