WormMine: Gene WBGene00069542

• WormBase Gene ID: WBGene00069542
• Gene Name: Cre-uaf-2
• Sequence Name: CRE28738
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity and metal ion binding activity. Predicted to be involved in mRNA splicing, via spliceosome. Predicted to be part of U2AF complex. Is an ortholog of C. elegans uaf-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28738.1	CRE28738.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28738	CRE28738		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101332
• Remark: Cre-uaf-2, CCACATGCTCTAAGGGAGGATTCTGCAACTTCATGCACTTGAAGGCCATTTCAGCAGAAT, WBGene00069542
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region