WormMine: Gene WBGene00070244

• WormBase Gene ID: WBGene00070244
• Gene Name: Cre-ipgm-1
• Sequence Name: CRE24737
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable manganese ion binding activity and phosphoglycerate mutase activity. Predicted to be involved in glucose catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans ipgm-1. In C. elegans, ipgm-1 is involved in carbohydrate metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24737.1	CRE24737.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24737	CRE24737		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1096270
• Remark: CRE24737, GAAACACGGATACTCACTCATGGTCACTGCCGATCATGGAAATGCGGAGAAGATGAAGGC, WBGene00070244
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region