WormMine: Gene WBGene00070531

• WormBase Gene ID: WBGene00070531
• Gene Name: Cre-ncbp-1
• Sequence Name: CRE07017
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA cap binding activity. Predicted to be involved in RNA metabolic process and mRNA export from nucleus. Predicted to be part of nuclear cap binding activity complex. Is an ortholog of C. elegans ncbp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07017.1	CRE07017.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07017	CRE07017		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100796
• Remark: Cre-ncbp-1, AAAATCCATCCATGCTCTCCAGATGTCAGATATTTGATCGATGAAGAGGATACAGCACTC, WBGene00070531
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region