WormMine: Gene WBGene00071677

• WormBase Gene ID: WBGene00071677
• Gene Name: CRE01456
• Sequence Name: CRE01456
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 3,4-dihydroxy-5-polyprenylbenzoic acid O-methyltransferase activity and 3-demethylubiquinol-n 3-O-methyltransferase activity. Predicted to be involved in ubiquinone biosynthetic process. Is an ortholog of C. elegans coq-3. In C. elegans, coq-3 is involved in nematode larval development and ubiquinone biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01456.1	CRE01456.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01456	CRE01456		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098636
• Remark: CRE01456, CAACAAGTGGTCGTGGATGGAGTCGACCCAAGTCAACTATGGAATTCTTGCCGTGAAGAA, WBGene00071677
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region