WormMine: Gene WBGene00071890

• WormBase Gene ID: WBGene00071890
• Gene Name: Cre-nsy-4
• Sequence Name: CRE02613
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans nsy-4. In C. elegans, nsy-4 is involved in determination of left/right asymmetry in nervous system.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02613.1	CRE02613.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02613	CRE02613		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103885
• Remark: Cre-nsy-4, GCGAAGGATTCCGATGGTTTCAGTATTCAACGATCGAGCAGGACTAATGTCACGAATATT, WBGene00071890
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region