WormMine: Gene WBGene00072685

• WormBase Gene ID: WBGene00072685
• Gene Name: Cre-nog-1
• Sequence Name: CRE14378
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable GTP binding activity. Is an ortholog of C. elegans nog-1. In C. elegans, nog-1 is involved in determination of adult lifespan; negative regulation of lipid storage; and regulation of reproductive process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14378.1	CRE14378.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14378	CRE14378		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097781
• Remark: CRE14378, ACGTCTACGACCTCAAACCGAAGCATTTGTTCTGTGGAAAGAGAGGAAACGGAAAAACCG, WBGene00072685
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region