WormMine: Gene WBGene00074413

• WormBase Gene ID: WBGene00074413
• Gene Name: Cre-rad-51.2
• Sequence Name: CRE02731
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP hydrolysis activity; catalytic activity, acting on DNA; and organic cyclic compound binding activity. Predicted to be involved in double-strand break repair via homologous recombination and mitotic recombination-dependent replication fork processing. Is an ortholog of C. elegans rad-51. In C. elegans, rad-51 is involved in several processes, including intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator; meiotic chromosome condensation; and negative regulation of apoptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02731.1	CRE02731.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02731	CRE02731		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101124
• Remark: CRE02731, TGGTGCAATCGCCAAATCTTCCAGAAGCTGAAGCGACTTACTCGATCACTAATCATGGAA, WBGene00074413
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region