WormMine: Gene WBGene00074743

• WormBase Gene ID: WBGene00074743
• Gene Name: CRE17760
• Sequence Name: CRE17760
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable manganese ion binding activity and phosphoglycerate mutase activity. Predicted to be involved in glucose catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans ipgm-1. In C. elegans, ipgm-1 is involved in carbohydrate metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17760.1	CRE17760.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17760	CRE17760		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112896
• Remark: CRE17760, TAGCAGATGTTGCACCGACTATTTTAAGTTTAATGCATCTCCCTGTACCGACAGAAATGC, WBGene00074743
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region