WormMine: Gene WBGene00074826

• WormBase Gene ID: WBGene00074826
• Gene Name: Cre-phy-2.2
• Sequence Name: CRE20636
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and procollagen-proline 4-dioxygenase activity. Predicted to be located in endoplasmic reticulum. Is an ortholog of C. elegans phy-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20636.1	CRE20636.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20636	CRE20636		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113811
• Remark: CRE15564, AACCATTCCTAAAGATTGCACCAATCAAGGTCGAAATTCTTCGCTTCGATCCATTGGCTG, WBGene00066285
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region