WormMine: Gene WBGene00075032

• WormBase Gene ID: WBGene00075032
• Gene Name: CRE24891
• Sequence Name: CRE24891
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of proton-transporting V-type ATPase, V0 domain. Is an ortholog of C. elegans vha-5. In C. elegans, vha-5 is involved in several processes, including collagen and cuticulin-based cuticle development; exosomal secretion; and multicellular organismal-level water homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24891.1	CRE24891.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24891	CRE24891		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096323
• Remark: CRE24891, TATTCTCGGAATCACTCAAATGACATTTGGAGTCATTCTTTCATTCTTCAACCACACTTT, WBGene00075032
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region