WormMine: Gene WBGene00075246

• WormBase Gene ID: WBGene00075246
• Gene Name: Cre-tpa-1.1
• Sequence Name: CRE10038
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and diacylglycerol-dependent serine/threonine kinase activity. Is an ortholog of C. elegans tpa-1. In C. elegans, tpa-1 is involved in several processes, including defense response to other organism; positive regulation of antimicrobial peptide production; and positive regulation of axon regeneration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10038.1	CRE10038.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10038	CRE10038		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092649
• Remark: CRE10038, TGCATCAATCGATCCAGAAGCATTCCTGAACTTCTCTTATACGAATCCTCACTTCTCAAA, WBGene00075246
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region