WormMine: Gene WBGene00075315

• WormBase Gene ID: WBGene00075315
• Gene Name: CRE31641
• Sequence Name: CRE31641
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31641.1	CRE31641.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31641	CRE31641		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096321
• Remark: CRE31641, GATTCTCGATGAACCAACCTCAGCTCTTGATCGAACCACACAACGTGCGATTGTAAATTA, WBGene00075315
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region