WormMine: Gene WBGene00075614

• WormBase Gene ID: WBGene00075614
• Gene Name: Cre-ech-8.1
• Sequence Name: CRE13205
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable NAD+ binding activity and oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor. Predicted to be involved in fatty acid metabolic process. Is an ortholog of C. elegans ech-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE13205.1	CRE13205.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE13205	CRE13205		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101467
• Remark: CRE13205, CGCCGTAAATTTCCTATTGTATCCAATGTTCAATGAAGGTCTATTGTGTATTGAAGAAGG, WBGene00075614
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region