WormMine: Gene WBGene00077361

• WormBase Gene ID: WBGene00077361
• Gene Name: Cre-lig-4
• Sequence Name: CRE01184
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity; DNA binding activity; and DNA ligase (ATP) activity. Predicted to be involved in DNA ligation involved in DNA repair and DNA recombination. Is an ortholog of C. elegans lig-4. In C. elegans, lig-4 is involved in DNA repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01184.1	CRE01184.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01184	CRE01184		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113296
• Remark: Cre-lig-4, AAAATCACATCGAATGGAGTGAGAAATGGGAAATTGGTGGATCCGGTGATGAGAGAGTGG, WBGene00077361
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region