WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00077382 Gene Name  Cre-cup-5
Sequence Name  ? CRE01175 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable monoatomic cation channel activity. Is an ortholog of C. elegans cup-5. In C. elegans, cup-5 is involved in several processes, including cuticle development involved in collagen and cuticulin-based cuticle molting cycle; determination of adult lifespan; and lysosomal lumen acidification. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE01175.1 CRE01175.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE01175 CRE01175   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-cup-5, AATTAGACTTTTTGAATATGTGGTATGTGATGATTGTCGTCAACGATGCGCTCATTATTT, WBGene00077382   Expr1115735 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region