WormMine: Gene WBGene00077912

• WormBase Gene ID: WBGene00077912
• Gene Name: Cre-smf-1
• Sequence Name: CRE00141
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable metal ion transmembrane transporter activity. Predicted to be involved in metal ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans smf-1. In C. elegans, smf-1 is involved in monoatomic cation homeostasis; negative regulation of cellular response to manganese ion; and response to manganese ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00141.1	CRE00141.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00141	CRE00141		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110226
• Remark: Cre-smf-1, TGATCACATCTGCATTGATTCTTTCAATCAACGTGTATTTCATATCCGACTATGTTTCAT, WBGene00077912
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region