WormMine: Gene WBGene00078566

• WormBase Gene ID: WBGene00078566
• Gene Name: Cre-fan-1.1
• Sequence Name: CRE24731
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable nuclease activity and nucleic acid binding activity. Predicted to be involved in interstrand cross-link repair. Is an ortholog of C. elegans fan-1. In C. elegans, fan-1 is involved in DNA repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24731.1	CRE24731.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24731	CRE24731		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096621
• Remark: CRE16875, TAACGTTTTACCGGTTTGTAAACGAACTTTCGGATGGAGCAAAATGTCTTCTTGTACGAT, WBGene00084993
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region