WormMine: Gene WBGene00079084

• WormBase Gene ID: WBGene00079084
• Gene Name: CRE17745
• Sequence Name: CRE17745
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable monoatomic ion channel activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans egl-19. In C. elegans, egl-19 is involved in several processes, including determination of left/right asymmetry in nervous system; positive regulation of striated muscle contraction; and regulation of nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17745.1	CRE17745.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17745	CRE17745		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093269
• Remark: CRE17745, TTCTGCCAGAGATATCCCACTGACCTAATTATTTTTCAGGAAACAATTGAATACGTGTTC, WBGene00079084
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region