WormMine: Gene WBGene00081941

• WormBase Gene ID: WBGene00081941
• Gene Name: CRE17787
• Sequence Name: CRE17787
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor. Predicted to be involved in cellular aldehyde metabolic process. Is an ortholog of C. elegans alh-4 and alh-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17787.1	CRE17787.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17787	CRE17787		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109540
• Remark: CRE17787, AATTGACGATGTAATTGACTTTATTAATGGCAGACCGCGTCCACTTGCTTTATACTATTT, WBGene00081941
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region