WormMine: Gene WBGene00082218

• WormBase Gene ID: WBGene00082218
• Gene Name: Cre-ntl-9
• Sequence Name: CRE20295
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in mRNA catabolic process. Predicted to be part of CCR4-NOT complex. Is an ortholog of C. elegans ntl-9. In C. elegans, ntl-9 is involved in hemidesmosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20295.1	CRE20295.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20295	CRE20295		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1094462
• Remark: CRE20295, GAGGTGCTGGGCAGAATGTAAAAGTACGCGCTCAACAAGCTCTCAAGCAATGCCTTCCGG, WBGene00082218
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region