WormMine: Gene WBGene00082317

• WormBase Gene ID: WBGene00082317
• Gene Name: Cre-hlh-10
• Sequence Name: CRE19710
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable protein dimerization activity. Is an ortholog of C. elegans hlh-10. In C. elegans, hlh-10 is involved in negative regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE19710.1	CRE19710.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE19710	CRE19710		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110130
• Remark: Cre-hlh-10, GCATACATTGGATATCTGGGTGCAATTATGAAAGACGACGCCGTCGAGGAGGAGCAATTC, WBGene00082317
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region