WormMine: Gene WBGene00082922

• WormBase Gene ID: WBGene00082922
• Gene Name: CRE13873
• Sequence Name: CRE13873
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity and catalytic activity. Predicted to be involved in Mo-molybdopterin cofactor biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE13873.1	CRE13873.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE13873	CRE13873		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113405
• Remark: CRE13873, CGGTATTACCGTGTTTGAATTGGTTGGAGAAATACGCGCAGGTATTGAAGAAGATGTTCA, WBGene00082922
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region