WormMine: Gene WBGene00085182

• WormBase Gene ID: WBGene00085182
• Gene Name: Cre-isw-1
• Sequence Name: CRE25078
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity and nucleosome binding activity. Predicted to be involved in chromatin remodeling. Predicted to be located in nucleus. Is an ortholog of C. elegans isw-1. In C. elegans, isw-1 is involved in positive regulation of transcription by RNA polymerase II and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25078.1	CRE25078.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25078	CRE25078		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100578
• Remark: CRE25078, GTTGTAACACTCTCATCACTCTTATTGAACGTGAAATGGGAGAAGTCGCAGAGGCGAAGC, WBGene00085182
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region