WormMine: Gene WBGene00086139

• WormBase Gene ID: WBGene00086139
• Gene Name: CRE29819
• Sequence Name: CRE29819
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable several functions, including ATP binding activity; DNA binding activity; and DNA helicase activity. Is an ortholog of C. elegans rtel-1. In C. elegans, rtel-1 is involved in regulation of double-strand break repair via homologous recombination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29819.1	CRE29819.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29819	CRE29819		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116134
• Remark: CRE29819, AATTCTTCTGGAAACTCTCGCAAAGTCAGGATTCGATGGAAATTCAGTTGAACGACTGGT, WBGene00086139
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region