WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00087077 Gene Name  Cbr-rga-9
Sequence Name  ? CBG25663 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in signal transduction. Is an ortholog of C. elegans rga-9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG25663c.1 CBG25663c.1   [unknown]
Transcript:CBG25663b.1 CBG25663b.1   [unknown]
Transcript:CBG25663a.1 CBG25663a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG25663b CBG25663b   [unknown]
CDS:CBG25663c CBG25663c   [unknown]
CDS:CBG25663a CBG25663a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG25664, ACCCAACGTGTCCAATGTGTCTGATGAAAGTGTTCCAACTCGAAGAAGATCTCTGAAAAT, WBGene00087078   Expr1052739 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG25663, CCAGGTGGCATTTTTGGAAGAGATAATGAAGAGACACTATTCAACAGTGCTGCCACAGGA, WBGene00087077   Expr1068216 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region