WormMine: Gene WBGene00088763

• WormBase Gene ID: WBGene00088763
• Gene Name: CBG27349
• Sequence Name: CBG27349
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG27349a.1	CBG27349a.1		[unknown]
Transcript:CBG27349b.1	CBG27349b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG27349b	CBG27349b		[unknown]
CDS:CBG27349a	CBG27349a		[unknown]

0 RNAi Result

10 Allele

• WBVar00032459
• WBVar00005164
• WBVar00005169
• WBVar00005154
• WBVar00005159
• WBVar00111404
• WBVar00111405
• WBVar00111403
• WBVar00111406
• WBVar00111407

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057026
• Remark: CBG27349, GCAAAACTACTGCGAAATCTGTAAACTACCGGCTCACGGCTCTCACTTCGGAGCATTCAC, WBGene00088763
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region