Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG27847b.1 | CBG27847b.1 | [unknown] | |
Transcript:CBG27847a.1 | CBG27847a.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG27847a | CBG27847a | [unknown] | |
CDS:CBG27847b | CBG27847b | [unknown] |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG27847, CTAAACTTCCAATCTGCATGGCCAAGACTCATTTGTCGCTCTCATCGGATCCAACAAAGA, WBGene00089261 | Expr1058726 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |