WormMine: Gene WBGene00089411

• WormBase Gene ID: WBGene00089411
• Gene Name: CBG27997
• Sequence Name: CBG27997
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans M60.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG27997b.1	CBG27997b.1		[unknown]
Transcript:CBG27997a.1	CBG27997a.1		[unknown]
Transcript:CBG27997c.1	CBG27997c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG27997a	CBG27997a		[unknown]
CDS:CBG27997b	CBG27997b		[unknown]
CDS:CBG27997c	CBG27997c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060414
• Remark: CBG27997, TCTGGAGAATTGACAGTCGAGTTGCAGCCACTGAATCAATCTGAAGAACATACAGATTCC, WBGene00089411
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region