WormMine: Gene WBGene00119282

• WormBase Gene ID: WBGene00119282
• Gene Name: Cjp-uvs-1
• Sequence Name: CJA00079
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in response to UV. Is an ortholog of C. elegans uvs-1. In C. elegans, uvs-1 is involved in response to UV and transcription-coupled nucleotide-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00079.1	CJA00079.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00079	CJA00079		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084207
• Remark: CJA00079, AAACACGACGTTGAATCGACGCCTTCAGAAGACGTTCGGTTACGGCTTCACAAAAAGTTG, WBGene00119282
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region