WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119404 Gene Name  Cjp-atg-7
Sequence Name  ? CJA00200 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable ubiquitin-like modifier activating enzyme activity. Predicted to be located in cytoplasm. Is an ortholog of C. elegans atg-7. In C. elegans, atg-7 is involved in several processes, including dauer larval development; determination of adult lifespan; and positive regulation of autophagosome assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00200.1 CJA00200.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00200 CJA00200   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-atg-7, AAGAAGTGCGAGCATTCAAGTGAAGTACACGTGGCAACGGCCGAACGATGGTGAAGAAGG, WBGene00119404   Expr1087752 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00554, GCGTGCGGAGACGCCATCGCCCAAGAATTCCACCAAAATGGCTGGAAATTTGTGCGTGAC, WBGene00119758   Expr1075591 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  located_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  located_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region