WormMine: Gene WBGene00119405

• WormBase Gene ID: WBGene00119405
• Gene Name: Cjp-clh-2
• Sequence Name: CJA00201
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable voltage-gated chloride channel activity. Predicted to be involved in chloride transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans clh-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00201c.1	CJA00201c.1		[unknown]
Transcript:CJA00201b.1	CJA00201b.1		[unknown]
Transcript:CJA00201a.1	CJA00201a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00201a	CJA00201a		[unknown]
CDS:CJA00201b	CJA00201b		[unknown]
CDS:CJA00201c	CJA00201c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079637
• Remark: Cjp-clh-2, CAAGGATATGACTTATCGGGAAATGAAGGAGATTTTGCAACTCGCACCACATCTGAGATC, WBGene00119405
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region