WormMine: Gene WBGene00119722

• WormBase Gene ID: WBGene00119722
• Gene Name: Cjp-sgk-1
• Sequence Name: CJA00519
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; phosphatidylinositol binding activity; and protein serine/threonine kinase activity. Is an ortholog of C. elegans sgk-1. In C. elegans, sgk-1 is involved in several processes, including mesendoderm development; positive regulation of vitellogenesis; and regulation of protein localization to basolateral plasma membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00519.1	CJA00519.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00519	CJA00519		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076435
• Remark: Cjp-sgk-1, CTTCCAGTGGATTGGGAGAAACTTTTGAACAGAGAGCTCAAGGCTCCATTCATTCCAAAA, WBGene00119722
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region