WormMine: Gene WBGene00119723

• WormBase Gene ID: WBGene00119723
• Gene Name: Cjp-gcy-22
• Sequence Name: CJA00518
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable guanylate cyclase activity and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-22. In C. elegans, gcy-22 is involved in several processes, including positive regulation of calcium-mediated signaling; response to metal ion; and response to methionine.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00518a.1	CJA00518a.1		[unknown]
Transcript:CJA00518b.1	CJA00518b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00518b	CJA00518b		[unknown]
CDS:CJA00518a	CJA00518a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081359
• Remark: Cjp-gcy-22, AAAATCGCTCATCTGCCCAAAGAACGAATCAACATTCGAGTCGGACTGCATACAGGCCCA, WBGene00119723
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region