WormMine: Gene WBGene00119736

• WormBase Gene ID: WBGene00119736
• Gene Name: Cjp-gtf-2F1
• Sequence Name: CJA00531
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in positive regulation of transcription elongation by RNA polymerase II and transcription initiation at RNA polymerase II promoter. Predicted to be located in nucleus. Is an ortholog of C. elegans gtf-2F1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00531.1	CJA00531.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00531	CJA00531		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078188
• Remark: CJA00531, AGAATTTGAAACCGACAAAGGAGAAGAGGCAGCGAGTCGAAAATAGTGACGAAGTTGCGA, WBGene00119736
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region