WormMine: Gene WBGene00119875

• WormBase Gene ID: WBGene00119875
• Gene Name: Cjp-mig-6
• Sequence Name: CJA00671
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be involved in extracellular matrix organization. Is an ortholog of C. elegans mig-6. In C. elegans, mig-6 is involved in several processes, including anatomical structure morphogenesis; distal tip cell migration; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00671.1	CJA00671.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00671	CJA00671		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088307
• Remark: Cjp-ppn-1, CACTACGGTGGATGTCAGGGAAGCAACAACCGATTCGACAACGAACAACAGTGCAAGGCA, WBGene00119875
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region