WormMine: Gene WBGene00119880

• WormBase Gene ID: WBGene00119880
• Gene Name: Cjp-tir-1.2
• Sequence Name: CJA00676
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable NAD+ nucleosidase activity and signaling adaptor activity. Predicted to be involved in negative regulation of MyD88-independent toll-like receptor signaling pathway; response to axon injury; and signal transduction. Is an ortholog of C. elegans tir-1. In C. elegans, tir-1 is involved in several processes, including NAD catabolic process; defense response to other organism; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00676.1	CJA00676.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00676	CJA00676		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083846
• Remark: Cjp-tir-1, CGAATGATCACAAAGTACAACGGAGTCAAATGGGTGCACGACTATCAGGATGCTTGCATG, WBGene00119880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region