WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119973 Gene Name  Cjp-mel-11
Sequence Name  ? CJA00769 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable protein kinase binding activity. Is an ortholog of C. elegans mel-11. In C. elegans, mel-11 is involved in embryo development and embryonic body morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00769.1 CJA00769.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00769 CJA00769   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-mel-11, CTCACGAGGAACATGTGCTTTCGACGCAACGGAAGATTGACTTACAGCACAAAGATCAGT, WBGene00134492   Expr1086256 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00769, GAATGGAGAATCAGCGGCTGAAAGAGGAGAACGGAGCGCTGGTGCGAGTGATATCCAAAA, WBGene00119973   Expr1072000 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22661, GAATCAAGTCCAGTGGAAGTTTGCAACGGAAAAGAGCCTTCTTTATCGCCTGCCAGATCG, WBGene00178233   Expr1074546 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region