WormMine: Gene WBGene00120156

• WormBase Gene ID: WBGene00120156
• Gene Name: Cjp-lars-2
• Sequence Name: CJA00952
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and leucine-tRNA ligase activity. Predicted to be involved in leucyl-tRNA aminoacylation. Is an ortholog of C. elegans lars-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00952b.1	CJA00952b.1		[unknown]
Transcript:CJA00952a.1	CJA00952a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00952a	CJA00952a		[unknown]
CDS:CJA00952b	CJA00952b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082461
• Remark: Cjp-lars-2, GACCAGAAATGGCCACAAGTCGACGCCGATGCCTCCATCGAGTTTCTTCTGATGATCGAC, WBGene00120156
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region