WormMine: Gene WBGene00120455

• WormBase Gene ID: WBGene00120455
• Gene Name: Cjp-oac-21
• Sequence Name: CJA01251
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity and acyltransferase activity, transferring groups other than amino-acyl groups. Predicted to be involved in DNA integration and DNA transposition. Is an ortholog of C. elegans oac-21.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01251a.1	CJA01251a.1		[unknown]
Transcript:CJA01251c.1	CJA01251c.1		[unknown]
Transcript:CJA01251b.1	CJA01251b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01251b	CJA01251b		[unknown]
CDS:CJA01251a	CJA01251a		[unknown]
CDS:CJA01251c	CJA01251c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088490
• Remark: Cjp-oac-52, AAAACCACTCAAACGTATCGATATTTTGATGAGCAGGGATTCTCATACTTCACAACTCCG, WBGene00120455
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region