WormMine: Gene WBGene00120499

• WormBase Gene ID: WBGene00120499
• Gene Name: Cjp-csb-1
• Sequence Name: CJA01295
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; ATP-dependent chromatin remodeler activity; and protein phosphatase regulator activity. Predicted to be involved in signal transduction. Predicted to be part of protein phosphatase type 2A complex. Is an ortholog of C. elegans csb-1. In C. elegans, csb-1 is involved in UV protection and transcription-coupled nucleotide-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01295b.1	CJA01295b.1		[unknown]
Transcript:CJA01295a.1	CJA01295a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01295b	CJA01295b		[unknown]
CDS:CJA01295a	CJA01295a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085449
• Remark: Cjp-csb-1, ATTTTTGTAAAACAGAAAGATCGTTCGAGCCCGACACAGATGTACTTTATCCACGAGATC, WBGene00120499
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region